Streptococcus suis serotype 2 ( SS2 ) is an significant zoonotic pathogen creditworthy for blood poisoning and meningitis. The redox-sensing regulator Rex has been reported to play critical roles in the metamorphosis regulation, oxidative stress response, and virulence of versatile pathogens. In this discipline, we identified and characterized a Rex ortholog in the SS2 virulent tenor SS2-1 that is involved in bacterial pathogenicity and try environment susceptibility. Our data show that the Rex-knockout mutant striving Δrex exhibited afflicted growth in metier with hydrogen peroxide or a depleted ph compared with the wildtype striving SS2-1 and the complemental strain CΔrex. In summation, Δrex showed a decrease grade of survival in whole blood and in RAW264.7 macrophages. further analyses revealed that Rex lack importantly attenuated bacterial virulence in an animal model. A comparative proteome psychoanalysis found that the expression levels of respective proteins involved in virulence and oxidative stress were significantly different in Δrex compared with SS2-1. Electrophoretic mobility transfer assays revealed that recombinant Rex specifically bound to the promoters of aim genes in a manner that was modulated by NADH and NAD +. Taken together, our data suggest that Rex plays critical roles in the virulence and oxidative stress response of SS2 .

Introduction

Streptococcus suis is an crucial zoonotic pathogen that has caused severe economic losses in the swine industry and endangered public health global ( Lun et al., 2007 ). Among the 33 serotypes defined based on capsular polysaccharide ( CPS ), serotype 2 ( SS2 ) is the most deadly and the most frequently isolated in affiliation with diseases in the majority of countries ( Hill et al., 2005 ). The first human case of S. suis contagion was reported in Denmark in 1968 ; by 2014, the total number of S. suis infections in humans was over 1600 ( Goyette-Desjardins et al., 2014 ). In China, two big outbreaks of SS2 occurred in 1998 and 2005, resulting in 25 human cases with 14 deaths and 215 human cases with 38 deaths, respectively ( Tang et al., 2006 ; Yu et al., 2006 ). During the past decades, numerous studies on S. suis have been performed ; however, the pathogenesis of S. suis infection is still not wholly known ( Segura et al., 2017 ) .
During the contagion process, pathogens confrontation changing environments and host immune systems ( Richardson et al., 2015 ). To deal with these hostile environments, infective bacteria have evolved or acquired regulative networks to sense and respond to environmental signals by modulating the formulation of refer genes. In S. suis, the signal regulative systems contained within the two-component systems ( TCSs ) such as SalK/R ( Li et al., 2008 ), NisKR ( Xu et al., 2014 ), CiaRH ( Li et al., 2011 ), and SsSTK/SsSTP ( Zhu et al., 2011, 2014 ; Fang et al., 2017 ; Zhang et al., 2017 ), stand-alone regulators ( SARs ) such as CcpA ( Willenborg et al., 2011, 2014 ) and Rgg ( Zheng et al., 2011 ), and other regulators such as CodY ( Feng et al., 2016 ), PerR ( Zhang et al., 2012 ), AdcR, and Fur ( Aranda et al., 2010 ) have been shown to be involved in bacterial metabolism and virulence. To gain promote insight into the global regulative networks of SS2, the function of other uncharacterized regulators should be investigated .
The redox-sensing regulator Rex was first discovered in Streptomyces coelicolor and is widely distributed among gram-positive bacteria ( Richardson et al., 2015 ). The crystal structures of Rex proteins from Thermus aquaticus and Bacillus subtilis in complex with NADH, NAD+, and/or DNA operator have been determined ( Mclaughlin et al., 2010 ; Wang et al., 2011 ). Rex is composed of two domains, an N-terminal winged-helix DNA-binding domain and a C-terminal Rossmann-like knowledge domain involved in NADH bind and fractional monetary unit dimerization. The DNA-binding activity of Rex proteins is modulated by the proportion of NADH to NAD+ concentrations ( Brekasis and Paget, 2003 ; Mclaughlin et al., 2010 ). When the NADH/NAD+ ratio is broken, Rex binds to target genes and represses the transcription of genes involved in NAD+ regeneration. In contrast, a senior high school NADH/NAD+ ratio inhibits the DNA-binding activity of Rex and regulates the transcription of its prey genes ( Brekasis and Paget, 2003 ; Gyan et al., 2006 ; Pagels et al., 2010 ). The relationship between pathogenesis and the maintenance of an allow symmetry of shrink and oxidize NAD/NADH is not even clear, but in some bacteria, such as Staphylococcus aureus ( Pagels et al., 2010 ), Enterococcus faecalis ( Vesić and Kristich, 2013 ), and Streptococcus mutans ( Bitoun et al., 2012 ), the metabolic pathways under Rex control are implicated in virulence. In S. aureus, Rex is well involved in the survival of cells exposed to azotic oxide ( NO ), and it regulates genes involved in anaerobic respiration and zymosis ( Pagels et al., 2010 ). The Rex ortholog in S. mutans contributes to the oxidative stress response and biofilm formation of bacteria ( Bitoun et al., 2012 ; Bitoun and Wen, 2016 ). In E. faecalis, Rex has been shown to influence hydrogen peroxide ( H2O2 ) collection ( Vesić and Kristich, 2013 ).

here, we characterized a Rex ortholog in S. suis ( designed as SsRex ) and examined the roles of SsRex in the oxidative stress tolerance and virulence of SS2. The isogenic mutant Δ rex puree exhibited increased susceptibility to oxidative tension agents, decreased survival in blood and macrophages, and attenuated virulence in murine infection models, suggesting that SsRex plays important roles in the pathogenicity of S. suis .

Materials and Methods

Bacterial Strains, Plasmids, and Growth Conditions

The bacterial strains and plasmids used in this learn are listed in board 1. SS2 strain SS2-1 was isolated from a farrow with a black sheath of blood poisoning in Jiangsu state in 1998 and has been confirmed as acerb by animal experiments ( Zhu et al., 2014 ). SS2 strains were grown in Todd-Hewitt broth ( THB ) medium ( Difco Laboratories ) or plated on THB agar ( THA ) at 37°C. Escherichia coli strains were cultured in Luria-Bertani broth liquid medium or plated on Luria-Bertani agar. SS2 strains were grown in THB supplemented with 2 % yeast press out ( THY ) for the planning of competent cells. culture media was supplemented with antibiotics ( Sigma ) as required at the comply concentrations : spectinomycin ( Spc ), 100 μg/ml for SS2 and 50 μg/ml for E. coli; chloramphenicol ( Cm ), 4 μg/ml for SS2 and 8 μg/ml for E. coli .

table 1

www.frontiersin.org
Table 1. bacterial strains and plasmids used in this study .

Gene Inactivation and Functional Complementation

The thermosensitive suicide vector pSET4s was used for gene successor in S. suis through homologous recombination ( Takamatsu et al., 2001b ). All the primers and plasmids used in this discipline are listed in table 2. Two pairs of particular primers ( L1/L2 and R1/R2 ) were used for cloning the Rex upstream and downriver homologous regions carrying Hind III/ Sal I and BamH I/ EcoR I restriction enzyme sites, respectively. deoxyribonucleic acid fragments were digested with the corresponding limitation enzymes and directionally cloned into vector pSET4s. The cat gene construction cassette was amplified from pBR326 with primers CAT1/CAT2 and inserted at the Sal I/ BamH I sites to obtain the knockout vector pSET4sΔRex. To obtain the isogenic mutant Δ rex, SS2-1 competent cells were electrotransformed with pSET4sΔRex as described previously ( Takamatsu et al., 2001b ). SS2-1 containing pSET4sΔRex were grown at 28°C in the presence of Cm and Spc. Cells in mid-log growth phase were diluted 1,000-fold with THY broth containing Cm and cultured at 28°C to the early logarithmic increase phase. The acculturation was next moved to 37°C and incubated for 4 h before subsequent dilution and plating on THY-Cm plates and non-selective plates, which were then incubated at 37°C. Cultures were screened for vector-loss mutants that had exchanged their wild-type ( WT ) allele for a genetic section containing the rex gene after homologous recombination via a double crossing. For all CmR transformants, colony PCR assays with primers IN1/IN2 were performed to detect the presence of rex in the genome. Candidate mutants in which the rex failed to be amplified were further verified by PCR assays with primers CAT1/CAT2, OUT1/CAT2, and CAT1/OUT2 and then confirmed by deoxyribonucleic acid sequence .

table 2

www.frontiersin.org
Table 2. Primers used in this study .

The SsRex showman sequence was predicted based on computer psychoanalysis by using BPROM ( hypertext transfer protocol : //www.softberry.com/berry.phtml ). For functional complementary distribution, the showman region ( 372 bp ) and open reading skeleton of the Rex sequence ( 639 bp ) were amplified by PCR using specific primers C1/C2 ( carrying Sph I/ Eco RI restriction enzyme sites ) and then cloned into pSET2 ( Takamatsu et al., 2001a ) to obtain the recombinant plasmid pSET2-Rex, which was subsequently electroporated into Δ rex. The complement breed CΔ rex was screened on THY plates with double choice pressure of Spc and Cm and promote confirmed by PCR assays using primers IN1/IN2, CAT1/CAT2, and Spc1/Spc2 .

Adherence and Invasion Assays

The adhesiveness and invasion assays were performed using HEp-2 cells as trace previously, with some modifications ( Feng et al., 2016 ). HEp-2 cells were cultured in DMEM metier ( Hyclone ), maintained at 37°C, and supplemented with 10 % ( vol/vol ) fetal bovine serum ( FBS ) ( Sijiqing, Hangzhou, China ). In the attachment assays, log-phase bacteria ( 107 CFU ) were added to the wells of a 24-well tissue polish plate containing a monolayer ( 105 cells ) of HEp-2 cells ( multiplicity of infection [ MOI ] of 100 bacteria/HEp-2 cell ). The plates were incubated for 2 hydrogen at 37°C in 5 % CO2 to allow cell attachment by the bacteria. The monolayers were then washed four times with PBS, digested with 100 μl of trypsin for 15 minute at 37°C, and then disrupted by the accession of 900 μl of sterile deionize water on frosting followed by repeated pipetting to release all bacteria. Aliquots ( 100 μl ) diluted 102 to 104 in PBS were used for quantitative plating .
For the invasion assays, log-phase SS2 ( 107 CFU ) at a MOI of 100 were incubated with HEp-2 cells at 37°C for 2 heat content, and then the culture suspensions were removed. DMEM culture medium containing ampicillin ( 100 μg/ml ) was added into the wells of cells infected with SS2 for 2 planck’s constant to kill the bacteria outside the host cells. The cells were then washed four times with PBS. A 100-μl sample of the stopping point PBS wash solution was plated on THA to test whether 100 % of extracellular bacteria were killed after the antibiotic treatment. The cells were treated with 100 μl of trypsin for 15 min and then disrupted by the addition of 900 μl of sterile deionize body of water on ice. Aliquots ( 100 μl ) of serial dilutions in PBS were used for quantitative plating. The experiments besides included negative control cells without SS2 infection, which were plated on THA. The attachment and invasion assays were each performed in triplicate and repeated three times .

Acid and Oxidative Stress Challenges

To evaluate the function of SsRex in acid and oxidative stress, SS2 WT and its mutant strains were challenged with HCl and H2O2 according to previously described protocols ( Han et al., 2012 ; Li et al., 2014 ). In the acid allowance assays, log-phase bacteria cultured in THB ( pH 7.0 ) were harvested by centrifugation at 3000 × g at 4°C for 10 min, washed once with 0.1 M glycine buffer zone ( ph 7.0 ), and then resuspended using THB with assorted pH values ( 4.0, 5.0, 6.0, and 7.0 ), which were achieved by alteration with HCl. The suspensions were incubated for astir to 4 h at 37°C, and the numbers of surviving cells were determined by plating them on THA plates in triplicate, followed by brooding at 37°C for 24 planck’s constant ( Han et al., 2012 ) .
In the oxidative stress permissiveness assays, log-phase bacteria were pelleted, washed, and resuspended in 0.1 M glycine buffer, ph 7.0. H2O2 was added to the cell abeyance to create a final examination concentration of 10 millimeter ( Han et al., 2012 ), and the cells were incubated for 15 minute, 30 minute, or 45 minute. The catalase was then added immediately ( 5 mg/ml ; Sigma ) to the samples to inactive the H2O2 ( Li et al., 2014 ). last, the survival pace was calculated by plating the samples in triplicate on THA plates. These experiments were performed in triplicate and repeated three times .

Intracellular Survival Assays

Murine macrophage RAW264.7 cells were cultured in DMEM supplemented with 10 % FBS in 24-well tissue culture plates at a assiduity of 4 × 105 cells/well for intracellular survival assays as trace previously, with some modifications ( Tang et al., 2012 ). Log-phase bacteria were pelleted, washed doubly with sterile PBS, and resuspended in bracing serum-free DMEM without antibiotics. The RAW264.7 cells were infected at a MOI of 10. After being co-cultured with the SS2 strains for 1 henry at 37°C in 5 % CO2, the macrophages were washed four times with PBS and then incubated in DMEM with 1 % FBS check ampicillin ( 100 μg/ml ) for the duration of the assays. For measuring the survival of intracellular bacteria, infect cells were sampled at 1 henry after the addition of antibiotics ( meter 0 ) and again at 2, 4, 6, 8, and 10 h. The cells were washed three times with sterile PBS and then incubated with 0.02 % Triton X-100 for 15 min at 37°C to lyse the macrophages and release intracellular bacteria. serial dilutions of these lysates were plated on THA plates and brood overnight at 37°C. Colonies were counted to determine the number of intracellular bacteria. To analyze the act of bacteria surviving over time compared with the initial act of intracellular bacteria, the relative CFU ( rCFU ) was calculated as follows : rCFU at time steer x/CFU at prison term point 0 ( Cumley et al., 2012 ). These experiments were performed with three biological replicates, each with two technical replicates .

Survival in Blood

The survival of SS2 in whole blood was determined as described in previous studies ( Feng et al., 2016 ). Briefly, 50 μl of mid-log-phase cultures of the SS2-1 and Δ rex strains, which had been pelleted, washed twice with sterile PBS, and adjusted to an OD600 of 0.1, were inoculated into aseptic Eppendorf tubes pre-filled with 450 μl of bracing heparinized pig blood from clinically healthy pigs. The blood-bacteria mixtures were incubated at 37°C for 2 h. Surviving bacteria were then diluted and plated on THA. These experiments were performed in duplicate and repeated three times .

Mouse Infections

All animal experiments were approved by the Science and Technology Agency of Jiangsu Province. Approval ( ID : XYSK 2015-0020 ) was besides granted by the Jiangsu Academy of Agricultural Sciences Experimental Animal ethics committee. All efforts were made to minimize the suffering of the animals. The BALB/c shiner ( female, 4–6 weeks erstwhile ) were obtained from Yangzhou Laboratory Animal Research Center, Yangzhou, China. A sum of 80 female BALB/c mouse were randomly classified into 10 groups with 8 mice per group. Log-phase cultures of SS2 strains were centrifuged, and the resulting cell pellets were washed twice in PBS and then suspended in THY. For each tune, three groups of experimental mice were injected intraperitoneally ( information science ) with 1.0 ml of bacterial suspension at the be concentrations : 4.20 × 107 CFU/ml, 8.40 × 106 CFU/ml, and 1.68 × 106 CFU/ml. The last group shiner ( 8 control mouse ) were inoculated with only the medium solution ( THY ). Mortality was monitored until 7 days post-infection, after which the 50 % deadly venereal disease ( LD50 ) value was calculated using the method acting of Reed and Muench ( Reed Lj, 1938 ) .

Protein Digestion and iTRAQ Labeling

All the SS2 strains were grown in THB in triplicate ( three WT strain SS2-1 and three mutant striving Δ rex ) .When the SS2 cultures reached an OD600 of 0.7, 80 milliliter of sample were taken from each culture and pooled ( 240 ml sum book ) ( Redding et al., 2006 ). The samples were centrifuged at 10,000 × g for 5 minute at 4°C, and the resulting cell pellets were then washed doubly with PBS ( Shen et al., 2013 ). iTRAQ psychoanalysis was carried out at Wuhan GeneCreate Biological Engineering Co., Ltd. ( Wuhan, GeneCreate, China ). Protein digestion was performed as previously described ( Jing et al., 2008 ) with some modifications. Briefly, bacterial cell pellets were ground to powder in liquid nitrogen and incubated in profligacy buff ( 8 M urea/100 millimeter triethylammonium hydrogen carbonate buffer [ TEAB ], ph 8.0 ) containing 1 millimeter PMSF and 2 millimeter EDTA ( concluding concentration ) for 5 min, and 10 millimeter DTT ( final examination concentration ) was then added to the sample distribution. The suspension was sonicated for 15 min and then centrifuged at 4°C at 14,000 × g for 20 min. The resulting supernatant was mix with four volumes of precooled acetone at −20°C overnight. After another centrifugation, the resulting protein pellets were air-dried and resuspended in 8 M urea/100 millimeter TEAB ( pH 8.0 ). Protein samples were reduced with 10 mM DTT at 56°C for 30 min and then alkylated with 50 mM iodoacetamide ( IAM ) for 30 min in the dark. The protein concentration was measured using the Bradford Protein Assay Kit ( Beyotime, Shanghai, China ). After being diluted 5× with 100 mM TEAB, peer sum of proteins from each sample distribution were used for tryptic digestion. Trypsin was added at an enzyme protein ratio of 1:50 ( w/w ), and the digest reaction was performed at 37°C for 12–16 h. After digestion, peptides were desalted using C18 column, and the resulting desalinate peptides were dried with a vacuum concentration meter. The dry peptide powderize was later re-dissolved with 0.5 M TEAB and processed according to the manufacturer ‘s instructions for the iTRAQ Reagent-8 plex Multiplex Kit ( AB Sciex U.K. Limited ). The peptides from the WT form SS2-1 were labeled with iTRAQ tag 119, and the peptides from the mutant form Δ rex were labeled with chase 121. The peptide samples were fractionated using a Durashell C18 column ( 5 μm, 100 Å, 4.6 × 250 millimeter ) on an ultimate 3000 HPLC system ( Thermo DINOEX, USA ) operating at 1 ml/min. Peptides were separated by increasing acetonitrile ( ACN ) concentrations under high ph ( ph 10 ) conditions. Fractions were collected at 1-ml intervals and pooled into 12 fractions. Each divide was dried with a vacuum concentration meter .

LC-ESI-MS/MS Analysis

The peptide samples were dissolved in 2 % acetonitrile/0.1 % formic acid and analyzed using a Triple TOF 5600+ mass mass spectrometer coupled with the Eksigent nanoLC System ( SCIEX, USA ) as previously described ( Lin et al., 2015 ). The crude files collected from the Triple TOF 5600 were interpreted by ProteinPilot version 4.5 ( July 2012, Applied Biosystems ; Foster City, CA, USA ). MS/MS spectrum were searched against the Uniprot S. suis database ( 80,299 items, updated Jan 2017 ). The adopt search parameters were used : the legal document was set as TripleTOF 5600 plus with cysteine carbamidomethylation and 8 multiplex iTRAQ label was set as a fixed alteration, methionine oxidation as a variable star modification, and digestion by trypsin with at less one missed cleavage. The proportion of label 119 to label 121 represents the construction of proteins with the protein designation confidence of a 1 % delusive discovery rate ( Unwin et al., 2010 ). The proteins were considered overexpressed when the iTRAQ ratio was above 1.5 and under-expressed when the iTRAQ ratio was lower than 0.67 ( Yu et al., 2018 ) .

Transcriptional Analysis

sum RNA was extracted from in vitro late log-phase ( OD600, 0.6–0.8 ) bacterial culture using the EZNA bacterial RNA kit ( Omega, Beijing, China ) according to the manufacturer ‘s protocol. complementary dna was reverse transcribe using a PrimeScript RT reagent kit with gDNA Eraser ( TaKaRa, Dalian, China ). The two-step relative quantitative actual time PCR ( qRT-PCR ) was performed to analyze the expression visibility of these selected genes using a SYBR Premix Ex Taq kit out ( TaKaRa ). The ABI 7500 RT-PCR system was used for proportional qRT-PCR. The gene-specific primers used for the qRT-PCR assays are listed in board 2. The housekeeping gene aroA ( encoding 5-enolpyruvylshikimate 3-phosphate synthase ) used as the internal restraint was besides amplified under the lapp conditions to normalize reactions. Reactions were performed in triplicate. A dissociation analysis of amplification products was performed at the conclusion of each PCR assay to confirm that merely one PCR product was amplified and detected. The relative fold change was calculated based on the 2−ΔΔ Ct method ( Livak and Schmittgen, 2001 ) .

Expression and Purification of the Recombinant Protein SsREX

The solid open take frame of SsRex was amplified by PCR with primers Rex-F and Rex-R contain added BamH I and Xho I recognition sites ( listed in Table 2 ). The PCR product was restriction-enzyme digest with Bam HI and Xho I and then inserted into the similarly digested pET-28a vector ( Novagen ) to generate the recombinant plasmid pET28a-Rex, which was then transformed into E. coli BL21 ( DE3 ) cells. The recombinant Rex protein was expressed via IPTG ( isopropyl–D-thiogalactopyranoside ) induction. The resulting fusion protein was purified using a HisTrap HP column ( GE Healthcare, Shanghai, China ) according to the manufacturer ‘s guidelines. The expression and purity of the fusion protein were determined by sodium dodecyl sulfate-polyacrylamide gelatin electrophoresis ( SDS-PAGE ). The purify protein was stored at 4°C for later function in electrophoretic mobility stir assays .

Electrophoretic Mobility Shift Assays (EMSAs)

Protein–DNA interactions were analyzed by performing EMSAs according to previously described protocols with some modifications ( Pagels et al., 2010 ; Bitoun et al., 2012 ). The promoter regions of the potential prey genes, which were selected according to our comparative proteomics results and findings from previous studies in other pathogens, were amplified by PCR from SS2-1 gDNA using the specific primers shown in table 2 and purified by using the eminent Pure PCR merchandise refining kit out ( Axygen, Hangzhou, China ). The purify PCR fragments were incubated with increasing amounts of rSsRex in reaction fender containing 20 millimeter Tris ph 8.0, 1 millimeter EDTA, 75 millimeter KCl, 2 millimeter DTT, and 10 % glycerol for 20 min at 30°C. When NAD+ or NADH was included for EMSAs, the samples were incubated for an extra 15 min ( Pagels et al., 2010 ; Bitoun et al., 2012 ). showman fragments of impdh ( Inosine 5-monophosphate dehydrogenase ) ( Zhou et al., 2014 ) lacking a putative Rex-binding web site and 16sRNA were used as negative controls. Another two master reactions in which lone included the DNA fragment or rRex protein were besides performed. The reaction mixtures were separated on a 6 % polyacrylamide mousse in 0.5× Tris-borate-EDTA for 60 min. After electrophoresis, the DNA mobility shift was visualized by staining with ethidium bromide using a Tanon 2500R imager .

Statistical Analysis

All the statistical analyses were performed using GraphPad Prism 5. one-way analysis of discrepancy ( ANOVA ) tests were used to analyze the oxidative stress, bacterial attachment, and survival in solid lineage assays. Mann-Whitney tests were used to analyze the bacterial load in all organs examined. two-way ANOVAs were performed on the qRT-PCR results. Values of P that were < 0.05 were considered significant .

Results

Bioinformatics Analysis of Rex in the S. suis Genome

The rex gene of SS2-1 has a 639-bp outdoors read frame and encodes a protein composed of 213 amino acids with a bode molecular mass of 23.7 kDa and an isolectric point of 8.27. BlastN analysis using the rex sequence of SS2-1 confirmed the presence of rex in all 35 complete S. suis genomes available in the National Centre for Biotechnology Information database as of 31 Dec 2017 ( data not shown ). BlastP psychoanalysis revealed that SsRex ( possessing N-terminal DNA-binding sites and a C-terminal Rossmann-fold NAD ( P ) H/NAD ( P ) ( + ) -binding [ NADB ] sphere ) exhibited more than 78 % amino acid sequence identity with the Rex homolog proteins in other Streptococci. multiple sequence alignments of the redox-sensing governor Rex from S. suis and other Streptococci revealed that Rex is highly conserved among Streptococcus species. Protein homology modeling was performed to predict the structure of SsRex, which may be useful for studying its active sites and designing therapeutics against S. suis infection. The secondary structure of SsRex is predicted to consist of nine α-helices, eight β-sheets, and three coils ( Data not shown ) .
The rex gene of SS2-1 is flanked downstream by chp, which encodes a conserved conjectural protein, and upstream by pp, which encodes a putative protease ( Figure 1A ). Computer based analysis using BPROM ( www.softberry.com ), a bacterial sigma70 promoter recognition platform, identified a putative −10 and −35 component of the rex showman situated 97 nucleotides upstream of the translational depart site ( GTG ) of Rex. The transcriptional exterminator signal was predicted by an on-line creature ( hypertext transfer protocol : //rna.igmors.u-psud.fr/toolbox/arnold/ ). It identified an inverted recur sequence ( TGAATATAAAA CAGGGGATCATACAGAACCCCTG CTTTCTTATACCCA ) ( underscore nucleotides denote palindrome sequence ) situated 36 nucleotides downriver of the catch coden ( TAA ) of rex that may be a transcriptional exterminator, suggesting that rex is monocistronically transcribed. Reverse transcription-PCR ( RT-PCR ) was performed using the primers CT-P1/P2 and CT-P3/P4 to analyze the recording of genes adjacent to rex and the results showed that rex was a individual transcript unit of measurement, confirming the predict results of on-line tools ( supplementary Figure 1 ). The binding sequence of Rex is highly conserved in gram-positive bacteria. The report consensus sequences in S. coelicolor ( 5′-TGTGAACNNNTTCACA-3′ ) ( Brekasis and Paget, 2003 ), B. subtilis ( 5′ -WWTGTGAANTNNTNNNCAAW-3′ ; W represents either A or T ) ( Wang et al., 2008 ), S. aureus ( Pagels et al., 2010 ) ( 5′ -TTGTGAAWWWWTTCACAA-3′ ), and S. mutans ( TTGTGAANNNNTTCACAA ) ( Bitoun et al., 2012 ) are very similar. In the SS2-1 filter, a putative Rex-binding sequence ( TGTTGATTTTTTCACAA ) in the Rex promoter region, which overlapped the −35 component, provides a feasible mechanism by which Rex feedback autoregulation could occur ( Figure 1C ). The EMSA results show that recombinant Rex ( rRex ) was able to bind to the showman regions of rex ( Prex ), and displayed a dose-dependent mobility chemise to the higher molecular multitude of rRex- Prex complexes. however, the rRex protein did not bind to the control DNA break up from 16S rRNA, and no binding was observed under these conditions, even with 150 ng of rRex protein ( Figure 1B ). These results further suggest that SsRex is an authentic Rex transcriptional divisor that is poised for autoregulation .

FIGURE 1

www.frontiersin.org
Figure 1. identification and word picture of redox-sensing regulator Rex in SS2. (A) Schematic diagram of regions flanking rex, with the arrows indicating the management of transcription and the numbers above indicating the size of the respective afford reading frames in base pair. (B) EMSA analysis shows interaction of rex showman ( Prex ) with recombinant Rex ( rRex ) protein. inclusion of rRex resulted in mobility switch and such interaction was concentration-dependent. (C) The promoter regions of selected genes identified in SS2-1 that contain putative Rex bind sites. The−35 regions ( blue baptismal font ) and−10 regions ( green baptismal font ) as determined by BPROM programs are shown in bluff type and putative Rex-binding sites are underscore. W indicates A or T .

Construction of Rex Knockout Mutant and Complemented Strains

An isogenic rex mutant of SS2 strain SS2-1 was constructed through homologous recombination ( supplementary Figure 2A ). One candidate mutant in which the rex gene failed to be amplified was found from more than 180 CmR transformants. The allelic replacement of the rex gene by the CatR in the mutant form was confirmed by multiple PCR analysis ( auxiliary Figure 2B ), and DNA sequence ( data not shown ). The complement puree was screened on THY plates with double survival pressure of Spc and Cm and further confirmed by PCR analysis ( auxiliary Figure 2C ), and DNA sequence ( data not shown ). A previous cogitation reported that the bacterial cells carrying the pSET vectors should be grown under appropriate antibiotic pressures, particularly when the recA mutant strains are used as the hosts ( Takamatsu et al., 2001a ). So we detected the construction levels of rex in SS2-1, Δ rex, and C Δ rex in bearing or absence of antibiotic imperativeness by using qRT-PCR. The expression level value of rex in the WT SS2-1 was set as 1.0 and the results were shown as proportional formula ratios compared to SS2-1. The qRT-PCR analysis showed that the expression level of rex in Δ rex was not detectable, and that of in CΔ rex with antibiotic, and CΔ rex in the absence of antibiotic blackmail were decreased by 0.32, and 0.45, respectively, compared with the WT tenor ( auxiliary Figure 2D ). There was no meaning difference between the CΔ rex strain under the two conditions with or without antibiotic. The qRT-PCR results confirmed the rex was transcribed after complementary distribution careless of the antibiotic blackmail .

Δrex Demonstrates Reduced Tolerance to Acid and Oxidative Stress Agents

During the infection march, S. suis is exposed to a hostile environment with diverse try factors, including nutritional privation, increase osmolality, lowered ph, and reactive oxygen species ( ROS ) generated by host phagocytes ( Zhu et al., 2014 ). Rex regulators play crucial roles in acid and oxidative stress allowance in several pathogens ( Pagels et al., 2010 ; Bitoun et al., 2012 ). To test whether SsRex affects the acidic and oxidative tolerance of SS2, we compared the survival rates of SS2-1, Δ rex, and CΔ rex strains under these try conditions in vitro. In a neutral ph environment, the survival rates of these three SS2 strains ( WT SS2-1, Δ rex, and CΔ rex ) were exchangeable ; in contrast, as the ph of the medium was lowered, the bacterial survival of Δ rex quickly decreased compared with the WT and the CΔ rex strains ( Figure 2A ). The results show that Δ rex had reduced tolerance to acidic united states public health service ( p < 0.01 ). In summation, when these three SS2 strains were challenged with H2O2 ( 10 millimeter H2O2 in THB ), Δ rex was importantly more susceptible to H2O2 compared with the WT and CΔ rex strains. however, there was no meaning dispute between the H2O2 susceptibility of Δ rex and CΔ rex following a 30 min-incubation in the oxidative try assay ( Figure 2B ). These results suggest that the expression of SsRex contributes to the immunity of SS2 to environmental stresses .

FIGURE 2

www.frontiersin.org
Figure 2. (A) In acid challenge assay, log phase SS2 cultures were harvested and washed once with 0.1 M glycine buffer zone ( ph 7.0 ), and then resuspended using THB with versatile pH values ( 4.0, 5.0, 6.0, and 7.0 ), which were achieved by adaptation with HCl. The suspensions were incubated for astir to 4 h at 37°C and the numbers of surviving cells were determined by plating them on THA plates in triplicate. (B) In H2O2 challenge assay, log phase SS2 were pelleted, washed and resuspended in 0.1 M glycine fender ( ph 7.0 ). H2O2 was added to the cell pause to create a final assiduity of 10 mM and brooding for 15, 30, and 45 min, respectively. then catalase was added immediately ( 5 mg/mL ; Sigma ) to the samples to inactive H2O2. Surviving cells were diluted appropriately, plated on THA plates. The share of the CFU was normalized to WT group designed as 100 % ( n. south, p > 0.05, ** p < 0.01 ) .

SsRex Did Not Affect the SS2 Adherence to or Invasion of HEp-2 Cells

successful establishment of infection by S.suis requires attachment to host cells, colonization of tissues, and in certain cases, cellular invasion followed by intracellular multiplication, dissemination to other tissues ( Tang et al., 2006 ). HEp-2 cells were used to evaluate the effcts of SsRex on the SS2 adhesion to and invasion of mammal cells. Compared with the WT puree SS2-1, Δ rex showed exchangeable adhesiveness and invasion levels ( p > 0.05 ) ( auxiliary Figure 3 ). These results indicate that SsRex was not crucial for SS2 adhesiveness to or invasion of HEp-2 cells .

SsRex Deficiency Reduced Ss2 Survival in Whole Blood and Macrophages

S. suis invasion from the mucosal surface into deeper tissues and its rake circulation are critical events in the growth of disease. consequently, S. suis survival in the blood is central to its pathogenesis ( Fittipaldi et al., 2012 ). To determine whether the deletion of SsRex affected the survival of SS2 in whole blood, we measured the survival ability of SS2 strains in hale pig blood. The survival rate of the WT strain SS2-1 was 45.0 %, which was significantly higher than that of Δ rex, which had a survival rate of 11.1 % ( p < 0.01 ) ( Figure 3A ). Compared with the mutant strain Δ rex, the survival rate of the complement tense CΔ rex was increased up to 16.2 %. however, although the stallion rex gene is complemented in CΔ rex ( auxiliary Figure 2D ), its survival rate in the rake bacterial assay was not a high as that of the WT strain ( Figure 3A ) .Similar discover had besides been reported in other study ( Ju et al., 2012 ) .

FIGURE 3

www.frontiersin.org
Figure 3. (A) Survival of WT SS2-1 in pig bed whole blood compared to that of the mutant strain Δ rex and complemented strain CΔ rex. Mixtures were incubated at 37°C for 2 h. A measure of 100 % was given to the CFU at time 0 h. The survival rate of Δ rex was significantly reduced compared to SS2-1. (B) intracellular increase of SS2 in RAW264.7 macrophages. The macrophages cells were infected with mid-log growth phase SS2 strains at a MOI of 10 ( bacteria : macrophage ) .The samples were taken 1 heat content after the summation of antibiotics ( meter nothing ) and then at 2, 4, 6, 8, and 10 h. The relative numbers of CFU ( rCFU ) were estimated by plating out the lysates of infect macrophages and counting the numbers of CFU at each time decimal point. Asterisks indicate the time points when the intracellular bacteria survival rates elicited by the Δ rex were significantly lower than those produced by WT infection .

once S. suis reaches abstruse tissues and/or the bloodstream, phagocytic cells play a pivotal function in the host defense against these invading pathogens during infection ( Fang et al., 2017 ). phagocytosis and intracellular survival assays were performed in RAW264.7 cells to assess the function of SsRex in the context of S. suis –phagocyte interactions. As shown in Figure 3B, there were no significant differences in the phagocytosis rates among SS2-1, Δ rex, and C Δ rex at timepoint of 0 h. however, significant differences were observed in the intracellular survival of SS2-1, Δ rex, and CΔ rex when they were co-incubated with macrophages for another 10 hydrogen ( Figure 3B ). Our results show that the mutant strain Δ rex exhibited significantly reduced resistance to killing after consumption by macrophages in a time-dependent manner ( Figure 3B ), indicating that SsRex importantly contributes to bacterial survival in macrophages and that its deletion results in the attenuate virulence of SS2 .

Deletion of SsRex Attenuates SS2 Virulence in Mice

previous studies have indicated that Rex proteins are important for the virulence of bacterial pathogens ( Bitoun et al., 2012 ; Bitoun and Wen, 2016 ). To determine whether SsRex is involved in the virulence of SS2, we compared the LD50 values of SS2-1, its mutant Δ rex, and the complementation strive CΔ rex in BALB/c shiner. As shown in table 3, at a senior high school bacterial venereal disease ( 4.20 × 107 CFU per animal ), mouse in the WT and mutant groups all presented severe clinical symptoms associated with blood poisoning during the first 36 hpi, including depression, conceited eyes, failing, and prostration. The death rate was 100 % ( 8/8 ) in the WT group and 87.5 % ( 7/8 ) in both the Δ rex and CΔ rex groups in the high dose trials. At an intermediate bacterial dose ( 8.40 × 106 CFU per animal ), most mouse in the WT group besides presented severe clinical symptoms and collapse during the first 36 hpi, and seven mice ( 87.5 % ) died from blood poisoning. Mice in the Δ rex group presented tone down clinical symptoms, and lone one sneak ( 12.5 % ) died ; four mouse ( 50 % ) died from blood poisoning in the CΔ rex group. At a low bacterial venereal disease ( 1.68 × 106 CFU per animal ), three mouse died in the WT group. In line, no clinical symptoms were observed in the Δ rex and CΔ rex groups, and all the mouse in these two groups survived until the end of the infection experiments. The LD50 value was 1.81 × 107 CFU/mouse for the Δ rex group, which is 7-fold higher than that of the WT SS2-1 group ( 2.51 × 106 CFU/mouse ), the LD50 respect was 8.40 × 106 CFU/mouse for the CΔ rex group. The results suggest that Rex lack impaired the virulence of SS2 in a BALB/c shiner contagion model .

table 3

www.frontiersin.org
Table 3. Values of LD50 on SS2-1, mutant and complemented strains for BALB/c mouse .

Differentially Expressed Proteins in the Δrex Mutant Strain

To determine which proteins are regulated by Rex, an iTRAQ analysis characterizing the differences in protein expression between the WT and Δ rex strains was performed. Compared with the WT strain SS2-1, 39 proteins were upregulated and 57 proteins were downregulated in Δ rex. The differentially expressed proteins ( DEPs ) between Δ rex and the WT sift are summarized in Supplementary Table 1. (I) KEGG pathway analysis of DEPs. To obtain an overview of the major flustered functions in Δ rex compared with the WT SS2-1, a KEGG nerve pathway enrichment analysis was conducted. Some of the DEPs in Δ rex were involved in metabolic pathways ( 7 proteins [ 46.67 % ] upregulated ; 14 proteins [ 73.68 % ] downregulated ), biosynthesis of secondary metabolites ( 5 proteins [ 33.33 % ] upregulated ; 8 proteins [ 42.11 % ] downregulated ), and microbial metamorphosis in divers environments ( 5 proteins [ 33.33 % ] upregulated ; 7 proteins [ 36.84 % ] downregulated ) ( Figure 4 ). Three metabolic pathways were importantly altered by rex deletion, including glycolysis/gluconeogenesis, the pentose phosphate pathway, and the citrate bicycle ( TCA cycle ) ( Figure 5 ), which were all associated with central metamorphosis ( Richardson et al., 2015 ). Five proteins, including 6-phosphogluconate dehydrogenase ( 6Pgd ), phosphomannomutase ( Pgm ), glucose-6-phosphate 1-dehydrogenase ( G6pdh ), L-lactate dehydrogenase ( Ldh ), and ribose-phosphate pyrophosphokinase ( Prs ), were significantly downregulated, and five proteins, including ATP-dependent 6-phosphofructokinase ( PfkA ), pyruvate/2-oxoglutarate dehydrogenase complex, dehydrogenase ( E1 ) component ( Pdh ), fumarate reductase flavoprotein fractional monetary unit ( FrdA ), and alcohol dehydrogenases ( AdhE, AdhP ) were significantly upregulated ( Figure 5 ). (II) SsRex regulates known virulence factors. The SsRex deletion significantly reduced the virulence of SS2. Among the 32 virulence factors ( VFs ) predicted by the Virulence Factor Database ( VFDB ) ( Chen et al., 2005 ), 14 known VFs of SS were among the DEPs in the Δ rex strain ( Fittipaldi et al., 2012 ), including 9 downregulated proteins and 5 upregulated proteins, such as the transcriptional regulators TreR and Dpr, adenylosuccinate synthetase ( PurA ), autolysins ( Ju et al., 2012 ), protease T ( PepT ) ( Yu et al., 2016 ), type I restriction enzyme protein ( HsdS ) ( Xu et al., 2017 ), aldol dehydrogenase ( AdhE ) ( Yu et al., 2018 ), foldase protein PrsA ( Jiang et al., 2016 ), sialic acidic synthase ( NeuB ), and arginine deiminase ( ArcA ) ( table 4 ). Another 18 VFs that have been reported in other pathogens were identified as DEPs in the Δ rex strain, including ATP-dependent zinc metalloprotease FtsH ( Choi et al., 2015 ), metalloendopeptidas ( PepO ) ( Agarwal et al., 2013, 2014 ), branched-chain-amino-acid transaminase ( IlvE ) ( Santiago et al., 2012 ), adenylosuccinate lyase ( PurB ) ( Connolly et al., 2017 ), and ATP-dependent protease ATP-binding fractional monetary unit ClpL ( Kwon et al., 2003 ) ( table 4, Supplementary Table 1 ) .

FIGURE 4

www.frontiersin.org
Figure 4. KEGG pathways enrichments in altered proteins in mutant tense Δ rex. (A) Up-regulated proteins and (B) Down-regulated proteins .

FIGURE 5

www.frontiersin.org
Figure 5. schematic representation of SS2 metabolic pathways differentially regulated in carbohydrate metamorphosis. Differentially expressed proteins are involved in glycolysis, citrate cycle, and pentose phosphate nerve pathway. Red semblance, up-regulated proteins ; blue sky color, down-regulated proteins .

postpone 4

www.frontiersin.org
Table 4. Virulence associated factors identified by iTRAQ in Δ rex and analyzed by qRT-PCR and EMSAs .

Transcriptional Analysis

Alterations in the formula grade of a protein may be due to a change in its messenger rna level. Twelve genes selected based on the DEPs in the Δ rex strain, including seven downregulated genes and five upregulated genes, were measured via qRT-PCR in the mutant and WT strains. The aroA gene was used as a see housekeeping gene. As shown in table 4, the transcript levels of the genes dpr, ilvE, pepT,treR, purA, purB, and ldh were significantly downregulated and those of adhE, adhP, clpL, frdA, and arcA were significantly upregulated in the mutant form Δ rex, which matched well with the comparative proteomics data .

DNA Binding Activity of SsRex

Rex is an autoregulation repressor that binds to the operators of its target genes, modulating them in response to the cellular NADH/NAD+ level ( Brekasis and Paget, 2003 ). To determine if SsRex is an authentic Rex transcriptional gene, we performed EMSAs to evaluate the oblige ability of rRex to its showman succession ( Rex-promoter, Prex ). As shown in Figure 1B, recombinant Rex ( rRex ) can bind to DNA fragments containing Prex, in the lapp manner as that reported for S. mutans ( Bitoun et al., 2012 ). To verify the aim function of Rex in the regulation of the alter genes, we used EMSAs to assess the interactions between rRex and the promoters of selected genes identified from the relative proteome and transcriptional analyses. We tested the promoters of four upregulated genes ( adhE, arcA, clpL, and frdA ) and four downregulated genes ( dpr, ldh,ilvE, and treR ). Six promoters that contained known consensus Rex-binding motifs ( shown in Figure 1C ) displayed a dose-dependent mobility shift to higher molecular bulk, indicating the formation of rRex–promoter complexes ( Figure 6A ). however, no mobility shift key was observed when rRex was shuffle with the promoter of clpL and ilvE, which demonstrated that the two genes were not directly regulated by Rex and whose promoter does not have an apparent Rex-box ( Figure 6A ). The results showed that adhE,arcA, frdA, and ldh were the Rex targets for SS2, alike to the previous reported in S. aureus ( Pagels et al., 2010 ) and S. mutans ( Bitoun et al., 2012 ; Bitoun and Wen, 2016 ). In accession, we found that the showman regions of the two regulators ( dpr and treR ) besides could be bound by rRex. To the best of our cognition, these two new genes promoters were identified as the targets of Rex which has been reported for the inaugural time. It was besides worth noting that Rex may besides act as a transcriptional activator, directly binding to the promoters of down-regulated genes, american samoa good as a repressor which had been extensively reported in some bacteria ( Brekasis and Paget, 2003 ; Gyan et al., 2006 ; Pagels et al., 2010 ) .

FIGURE 6

www.frontiersin.org
Figure 6. determination of Rex binding abilities by EMSAs. (A) Binding of purify rRex to the promoter regions of different genes using EMSAs. The resulting protein–DNA complexes were separated from unbound DNA fragments using native polyacrylamide gels. The deoxyribonucleic acid fragments were visualized by ethidium platitude staining. formation of stable Rex–DNA complexes resulted in one or more distinct shifted DNA bands. The promoter area of impdh, which is not regulated by Rex and whose showman sequence lacks a putative Rex oblige box, and 16sRNA deoxyribonucleic acid fragments were used as negative controls. (B) EMSAs were performed with PCR products of the promoter regions of rex incubated with 50 ng purified Rex protein and unlike concentrations of NAD+ and NADH. At lower concentration, NADH and NAD+ did not influence the rRex affinity to Prex and not change the mobility model. A higher concentration of NADH ( 50 millimeter ) completely prevents the constitution of rRex– Prex complexes, and 50 millimeter of NAD+ causes the complexes to dissociate slightly. (C) EMSAs were performed with PCR products of the promoter regions of arcA and ldh incubated with 50 ng purified rRex protein and 50 millimeter NAD+ or 50 millimeter NADH. The presence of 50 mM NADH inhibits promoter-DNA building complex formation for ParcA and Pldh. however, the binding affinity between rRex and ParcA is slenderly decreased in the presence of 50 millimeter NAD+, and rRex binds better to the Pldh when compared to ParcA under the same conditions .

To test if NADH and NAD+ affect the interaction between S. suis Rex and its blood relation operators, EMSAs were performed using the aim promoters Prex, ParcA, and Pldh. In the EMSA pre-reaction buffer zone, the rRex and the aim promoters were pre-incubated for 20 min, and NADH and/or NAD+ ( 10 millimeter, and 50 millimeter, final examination concentration ) were then added. As shown in Figure 6B, rSsRex can silent bind to Prex with 10 mM of NAD+ or 10 millimeter of NADH in the EMSA reaction system, as evidenced by the mobility chemise. The bearing of 50 millimeter of NADH about wholly prevents the constitution of rRex– Prex complexes, whereas the addition of 50 millimeter of NAD+ did not result in a obtrusive enhancement of Rex binding to the DNA fragment and exhibited a slender noise to the binding bodily process ( Figure 6B ). additionally, rRex bound the arcA and ldh promoters under the exchangeable conditions ( Figure 6C ). Although inclusion body of lower concentration of NADH and NAD+ did not have a major effect on the mobility transfer, the summation of higher concentration of NADH closely completely abolished such tie down natural process ( Figures 6B, C ). It was unexpected that high concentration of NAD+ slenderly impaired the formation of rRex-DNA complexes for some genes in S. suis. exchangeable findings had been reported for the Rex-family protein RSP in Thermoanaerobacter ethanolicus ( Pei et al., 2011 ). The results show that SsRex could bind to its showman region as an authentic Rex family protein and that the interaction was modulated by NADH and NAD+ .

Discussion

Bacterial pathogens use global regulative networks to sense and modify gene saying in response to changing environments. In some gram-positive bacteria, including S. aureus ( Pagels et al., 2010 ), B. subtilis ( Gyan et al., 2006 ; Wang et al., 2008 ), E. faecalis ( Vesić and Kristich, 2013 ), and S. mutans ( Bitoun et al., 2012 ; Bitoun and Wen, 2016 ), Rex proteins are ball-shaped transcriptional regulators that play a pivotal function in the rule of energy metabolism, stress allowance, and virulence ( Pagels et al., 2010 ; Bitoun et al., 2012 ; Vesić and Kristich, 2013 ; Laouami et al., 2014 ; Zhang et al., 2014 ; Hu et al., 2016 ; Liu et al., 2017 ). however, the function of Rex in SS2 had not been investigated in detail .
A bioinformatics analysis revealed that SsRex ( possessing N-terminal DNA-binding sites and a C-terminal Rossmann-fold NAD ( P ) H/NAD ( P ) ( + ) -binding ( NADB ) sphere ) exhibits > 78 % amino acid sequence identity with the Rex homolog proteins in other Streptococci. This conserve geomorphologic feature ensures that the Rex protein can to bind specific DNA sequences to regulate the construction of prey genes. In the present study, EMSAs revealed that both NADH and NAD+ could bind to rSsRex ( Figures 6B, C ). This find suggests that SsRex is a distinctive member of the Rex family of regulative proteins in that it has common structural features and like regulative mechanisms with other homolog proteins of the Rex class. furthermore, our EMSA analysis of selected promoters ( adhE, arcA, frdA, dpr, ldh, and treR ) with known Rex-binding sites besides demonstrated that these DNA sequences interact with rSsRex ( Figure 6A ) and the interaction was modulated by NADH and NAD+ ( Figures 6B, C ). Our extra analysis of these promoter regions/Rex-binding sites further showed that differences exist among respective promoters in their nucleotide compositions and positions to the translation initiation locate ( ATG or GTG or TTG ) ( Figure 1C ) .Microarray data in S. mutans showed that Rex-deficiency effected transcription dissimilarly, suggesting either the interest of other governor ( s ) and/or regulation levels that depend on the nucleotide composition of the Rex-binding site ( Bitoun et al., 2012 ). In S. aureus, Rex binding sites are localized within the showman regions of its target genes or are lone a few base pairs upstream or downriver of the showman regions. This recover supports the estimate that the tie of Rex at these sites prevents the bind of the RNA polymerase and hence hinders transcriptional trigger ( Pagels et al., 2010 ). however, farther studies are needed to elucidate the molecular mechanism of the Rex regulation participation of SS2 .
Rex proteins are significant for the virulence of S. mutans ( Bitoun et al., 2012 ; Bitoun and Wen, 2016 ). hera, the LD50 values of Δ rex calculated from BALB/c mouse infection model studies and in vivo colonization experiments ( data not shown ) display that the deletion of rex in S. suis resulted in change bacterial pathogenicity and that SsRex facilitates the virulence of SS2. The attenuation of Δ rex may be due to a direct effect of rex on the formula of VFs. The comparative protein saying profiles showed that, among the 96 DEPs in Δ rex, there were 32 VFs predicted by the VFDB, including 20 downregulated and 12 upregulated proteins ( table 4, Supplementary Table 1 ) such as L-lactate dehydrogenase ( Ldh ), aminopeptidase T ( AmpT ), adenylosuccinate lyase ( PurB ), and metalloendopeptidase ( PepO ). In Listeria monocytogenes, AmpT is a member of the M29 kin aminopeptidases that is involved in invasion and intracellular survival inside the host cells and is required for wide virulence in a murine infection model ( Cheng et al., 2015 ). In S. aureus, purine biosynthesis ( PurA, PurB ) is indispensable for its emergence in human lineage and in vivo pathogenicity in a zebrafish embryo model ( Connolly et al., 2017 ). In Streptococcus pneumoniae, PepO is a multifunctional plasminogen- and fibronectin-binding protein that modulates the complement attack by binding to the complement component C1q ( Agarwal et al., 2013, 2014 ) .
Our iTRAQ analysis besides identified 9 known S. suis VFs ( Fittipaldi et al., 2012 ) among the 32 VFs with repress construction in Δ rex, such as the transcriptional regulators TreR ( Wilson et al., 2007 ) and Dpr ( Zhang et al., 2012 ), PurA ( Wilson et al., 2007 ), autolysins ( Ju et al., 2012 ), PepT ( Yu et al., 2016 ), and HsdS ( Xu et al., 2017 ) ( table 4, Supplementary Table 1 ). In the SS2 deadly try S735, treR and purA were identified as VFs by a novel signature-tagged mutagenesis system, and S735 with mutations in these genes had attenuated virulence in both mouse and piglet infection models ( Wilson et al., 2007 ). In the SS2 acerb tenor ZY05719, hsdS was reported to facilitate phagocytosis and survival in whole blood and to enhance the bacterial survival ability against a peroxidation environment ( Xu et al., 2017 ). Furthermore, PepT was identified as a protein that is singular to a deadly song, and its mutant strain Δ pepT had attenuated virulence in a zebrafish model ( Yu et al., 2016 ). consequently, downregulation of these known VFs may be associated with the decrease level of survival in unharmed lineage and macrophages cells and the attenuate virulence of Δ rex .
In some bacteria, the metabolic pathways under Rex control are implicated in virulence ( Richardson et al., 2015 ). The GO term and KEGG pathway analyses showed that several DEPs, such as 6Pgd, Pgm, G6pdh, Ldh, PfkA, Pdh, FrdA, and Adh, put up to complicated cellular metabolic pathways ( Figure 5 ), including glycolysis/gluconeogenesis, the pentose phosphate pathway, and the TCA cycle ( Richardson et al., 2015 ). In the present learn, the EMSAs showed that rRex can bind to the promoters of ldh and frdA ( Figure 6A ). previous studies reported that LDH and ADH are besides Rex targets ( Larsson et al., 2005 ; Pagels et al., 2010 ; Mehmeti et al., 2011 ). In S. aureus, Rex is well involved in the survival of cells exposed to NO. Because NO inhibits the activities of end respiratory oxidases, nitrate reductase, and pyruvate formate lyase, it leaves LDH, a aim of Rex, as the major means of regenerating NAD+ ( Pagels et al., 2010 ). LDH enables the bacteria to resist host congenital exemption, which means that modulating Rex routine appropriately is a critical factor in the pathogenesis of S. aureus ( Richardson et al., 2008 ). In S. pneumoniae, LDH, which is a key enzyme for pyruvate metabolism, was reported to be important for pneumococcal survival in lineage, metabolism, and virulence ( Gaspar et al., 2014 ). In SS2, 6PGD was found to be a good adhesin, and it induced protective immune responses in both mice and piglets ( Tan et al., 2008, 2009 ) .
During infection, phagocytic cells play a pivotal function against invading pathogens. The process of phagocytic kill begins with the engulfment of bacteria by endocytosis into phagosomes, which are then fused with lysosomes to form phagolysosomes ( Chen et al., 2008 ). The formation of phagolysosomes, a hostile environment with versatile reactive oxygen species ( ROS ) and a lower ph, is essential for the intracellular destruction of pathogens. In our studies, Δ rex displayed defects in its ability to adapt to oxidative and acidic environmental conditions and had a decreased level of survival in macrophages. similar results have been reported in other pathogens ; for example, Rex-deficiency in S. mutans causes increased sensitivity to exogenous H2O2-mediated kill ( Bitoun et al., 2012 ). In E. faecalis, a Rex-deficient mutant had an impaired ability to cope with oxidative stress ( Mehmeti et al., 2011 ; Vesić and Kristich, 2013 ). here, our iTRAQ results showed the downregulation of respective proteins ( such as Dpr, IlvE ) that are involved in the stress reception in Δ rex ; these might be partially responsible for the phenotypes of defective growth under conditions of oxidative and acidic stresses. Dpr is specially all-important for the H2O2 resistance of SS2, and deactivation of dpr led to a about dispatch loss of the SS2 H2O2 defensive capability ( Zhang et al., 2012 ). The EMSAs besides revealed that rSsRex can bind to the promoters of dpr ( Figure 6A ), suggesting that Rex may directly regulate oxidative stress response of SS2. In S. mutans, IlvE was upregulated in a proteome analysis under acidic stress conditions, and a deletion of ilvE caused a decrease in acid tolerance ( Santiago et al., 2012 ). In SS2, a group of global regulators such as Spx proteins ( Zheng et al., 2014 ), SalK/SalR ( Li et al., 2008 ), Ihk/Irr ( Han et al., 2012 ) were positively related to oxidative stress permissiveness of bacterial, these genes mutants exhibited impaired growth in the presence of H2O2 in vitro and importantly decreased survival in vivo. These findings suggest that the Rex governor in SS2 might not entirely be responsible for the bad growth of the mutant strive under stress conditions, but besides facilitate the survival of SS2 within the host .
In our study, we found that a Rex mutation made the SS2 more susceptible to acidic and oxidative environments and easily to be eliminated in whole lineage. however, there was no significant deviation between mutant tense Δ rex and complemented puree CΔ rex in the resistance to an H2O2 environment ( for a 30-min incubation ) and the wholly rake environment. It is interesting that the complementary distribution of Δ rex was able to restore the WT phenotype in the acid stress assay, but, it was not able to rescue the mutant phenotypes in the oxidative stress assay ( for a 30-min incubation ) or in the blood survival assay. exchangeable observations have been reported in early studies ( Behlau and Miller, 1993 ; Ju et al., 2012 ; Mcgillivray et al., 2014 ; Lewis et al., 2015 ). The most likely reasons are that ( one ) Rex functional complementation is mediated by a plasmid, which might be unlike from complementing the target genes into the genome of bacteria ( Dortet et al., 2011 ; Lewis et al., 2015 ). A previous study reported that the plasmid-mediated complementation for Rv2745c gene in Mycobacterium tuberculosis resulted in either a partial or, a delay complementary distribution of the phenotypes ( Mcgillivray et al., 2014 ), and ( two ) the arrangement level of rex and/or that of some genes within Rex regulon of the complement song CΔ rex may occur within a few microenvironments ( such as in wholly rake ), which might be due to a junior-grade answer of genes repression. foster researches are needed to identify that the genes expression patterns under Rex regulation in hale blood and the regulative elements within Rex regulation networks that impact expression of rex at different environmental conditions .
In compendious, bioinformatic, mutational, and proteomic analyses adenine well as EMSAs were used to identify and characterize the Rex regulator of SS2. The present sketch has intelligibly demonstrated that SsRex is an authentic Rex transcriptional divisor based on the follow testify : ( one ) it was able to bind to promoter fragments in vitro, indicating that, at least in some cases, the effect of Rex is mediated by direct interaction with promoters such as those for Rex, ArcA, and AdhE, and ( two ) it impacted the cellular metabolism, oxidative stress tolerance, and virulence, as previously reported for Rex homolog proteins in other pathogens ( Pagels et al., 2010 ; Bitoun et al., 2012 ; Laouami et al., 2014 ; Bitoun and Wen, 2016 ). We besides demonstrated that the Rex mutant song showed a dilute ability to colonize host tissues and a decrease survival in whole lineage or following phagocytosis, which partially explains the attenuate bacterial pathogenicity of the Rex mutant strive in animal models. promote investigations of the Rex-related protein construction patterns under in vivo infection conditions or host environment mimics are needed ; however, our survey provides novel insights into the prerequisite for Rex in the pathogenesis of SS2 infection .

Author Contributions

HZ, YW, KH conceived and designed the experiments. HZ, YW, LH performed the experiments. HZ, YW, JZ analyzed the data. YN, ZY, DW, AM, HF contributed reagents materials psychoanalysis tools. HZ, YW, KH wrote the paper. All authors read, advised, and approved the final manuscript .

Funding

This work was supported by the National Natural Sciences Foundation of China ( 31302114 ), the special Fund for Public Welfare Industry of Chinese Ministry of Agriculture ( 201303041 ), the National Transgenic Major Program ( 2014ZX0800946B ), the Innovation of Agricultural Sciences in Jiangsu state ( CX ( 14 ) 5042 ). The funders had no character in study design, data collection and analysis, decisiveness to publish, or cooking of the manuscript .

Conflict of Interest Statement

The authors declare that the research was conducted in the absence of any commercial or fiscal relationships that could be construed as a likely conflict of sake .

Acknowledgments

We are grateful to Dr. Takamatsu and colleagues ( National Institute of Animal Health, Japan ) for supplying the plasmid pSET4s and their cherished guidance for correctly using this plasmid. comparative proteomics were performed with the assistant of Wuhan GeneCreate Biological Engineering Co., Ltd. We thank Katie Oakley, PhD, from Liwen Bianji, Edanz Editing China ( www.liwenbianji.cn/ac ), for editing the English text of a enlist of this manuscript.

Supplementary Material

The Supplementary Material for this article can be found on-line at : hypertext transfer protocol : //themedipia.com/articles/10.3389/fcimb.2018.00317/full # supplementary-material

References

Agarwal, V., Kuchipudi, A., Fulde, M., Riesbeck, K., Bergmann, S., and Blom, A. M. ( 2013 ). Streptococcus pneumoniae endopeptidase O ( PepO ) is a multifunctional plasminogen- and fibronectin-binding protein, facilitating evasion of natural immunity and invasion of host cells. J. Biol. Chem. 288, 6849–6863. department of the interior : 10.1074/jbc.M112.405530
PubMed Abstract | CrossRef Full Text | Google Scholar Agarwal, V., Sroka, M., Fulde, M., Bergmann, S., Riesbeck, K., and Blom, A. M. ( 2014 ). Binding of Streptococcus pneumoniae endopeptidase O ( PepO ) to complement component C1q modulates the complement attack and promotes host cell attachment. J. Biol. Chem. 289, 15833–15844. department of the interior : 10.1074/jbc.M113.530212
PubMed Abstract | CrossRef Full Text | Google Scholar Aranda, J., Garrido, M. E., Fittipaldi, N., Cortes, P., Llagostera, M., Gottschalk, M., et aluminum. ( 2010 ). The cation-uptake regulators AdcR and Fur are necessary for broad virulence of Streptococcus suis. Vet Microbiol. 144, 246–249. department of the interior : 10.1016/j.vetmic.2009.12.037
PubMed Abstract | CrossRef Full Text | Google Scholar Bitoun, J. P., Liao, S., Yao, X., Xie, G. G., and Wen, Z. T. ( 2012 ). The redox-sensing regulator Rex modulates central carbon paper metamorphosis, stress permissiveness answer and biofilm formation by Streptococcus mutans. PLoS ONE 7 : e44766. department of the interior : 10.1371/journal.pone.0044766
PubMed Abstract | CrossRef Full Text | Google Scholar Cheng, C., Wang, X., Dong, Z., Shao, C., Yang, Y., Fang, W., et alabama. ( 2015 ). Aminopeptidase T of M29 family acts as a fresh intracellular virulence agent for Listeria Monocytogenes infection. Sci. Rep. 5:17370. department of the interior : 10.1038/srep17370
PubMed Abstract | CrossRef Full Text | Google Scholar Choi, E., Kwon, K., and Lee, E. J. ( 2015 ). A single amino acerb of a Salmonella virulence protein contributes to pathogenicity by protecting from the FtsH-mediated proteolysis. FEBS Lett. 589, 1346–1351. department of the interior : 10.1016/j.febslet.2015.04.014
PubMed Abstract | CrossRef Full Text | Google Scholar Cumley, N. J., Smith, L. M., Anthony, M., and May, R. C. ( 2012 ). The CovS/CovR acidic reaction governor is required for intracellular survival of group B Streptococcus in macrophages. Infect. Immun. 80, 1650–1661. department of the interior : 10.1128/IAI.05443-11
PubMed Abstract | CrossRef Full Text | Google Scholar Dortet, L. S., Mostowy, A., Samba-Louaka, E., Gouin, M. A., Nahori, E. A., Wiemer, E. A., et alabama. ( 2011 ). recruitment of the major vault protein by InlK : a Listeria monocytogenes strategy to avoid autophagy. PLoS Pathog 7 : e1002168. department of the interior : 10.1371/annotation/a70544fc-6d8b-4549-921a-9e86557b0ffc
PubMed Abstract | CrossRef Full Text | Google Scholar Fittipaldi, N., Segura, M., Grenier, D., and Gottschalk, M. ( 2012 ). virulence factors involved in the pathogenesis of the infection caused by the swine pathogen and zoonotic agent Streptococcus suis. Future Microbiol. 7, 259–279. department of the interior : 10.2217/fmb.11.149
PubMed Abstract | CrossRef Full Text | Google Scholar Gaspar, P., Al-Bayati, F. A., Andrew, P. W., Neves, A. R., and Yesilkaya, H. ( 2014 ). Lactate dehydrogenase is the key enzyme for pneumococcal pyruvate metabolism and pneumococcal survival in blood. Infect. Immun. 82, 5099–5109. department of the interior : 10.1128/IAI.02005-14
PubMed Abstract | CrossRef Full Text | Google Scholar Goyette-Desjardins, G., Auger, J. P., Xu, J., Segura, M., and Gottschalk, M. ( 2014 ). Streptococcus suis, an significant farrow pathogen and emerging zoonotic agent-an update on the global distribution based on serotyping and sequence type. Emerg. Microbes Infect. 3 : e45. department of the interior : 10.1038/emi.2014.45
PubMed Abstract | CrossRef Full Text | Google Scholar Gyan, S., Shiohira, Y., Sato, I., Takeuchi, M., and Sato, T. ( 2006 ). regulative loop between oxidation-reduction sense of the NADH/NAD ( + ) ratio by Rex ( YdiH ) and oxidation of NADH by NADH dehydrogenase Ndh in Bacillus subtilis. J. Bacteriol. 188, 7062–7071. department of the interior : 10.1128/JB.00601-06
PubMed Abstract | CrossRef Full Text | Google Scholar Han, H., Liu, C., Wang, Q., Xuan, C., Zheng, B., Tang, J., et aluminum. ( 2012 ). The two-component system Ihk/Irr contributes to the virulence of Streptococcus suis serotype 2 sift 05ZYH33 through change of the bacterial cell metabolism. Microbiology 158, 1852–1866. department of the interior : 10.1099/mic.0.057448-0
PubMed Abstract | CrossRef Full Text | Google Scholar Hill, J. E., Gottschalk, M., Brousseau, R., Harel, J., Hemmingsen, S. M., and Goh, S. H. ( 2005 ). biochemical analysis, cpn60 and 16S rDNA sequence data indicate that Streptococcus suis serotypes 32 and 34, isolated from pigs, are Streptococcus orisratti. Vet. Microbiol. 107, 63–69. department of the interior : 10.1016/j.vetmic.2005.01.003
PubMed Abstract | CrossRef Full Text | Google Scholar Jiang, X., Yang, Y., Zhou, J., Zhu, L., Gu, Y., Zhang, X., et aluminum. ( 2016 ). Roles of the putative type IV-like secretion system cardinal component VirD4 and PrsA in pathogenesis of Streptococcus suis type 2. Front. Cell Infect. Microbiol. 6:172. department of the interior : 10.3389/fcimb.2016.00172
PubMed Abstract | CrossRef Full Text | Google Scholar Ju, C. X., Gu, H. W., and Lu, C. P. ( 2012 ). characterization and functional analysis of atl, a novel gene encoding autolysin in Streptococcus suis. J. Bacteriol. 194, 1464–1473. department of the interior : 10.1128/JB.06231-11
PubMed Abstract | CrossRef Full Text | Google Scholar Kwon, H. Y., Kim, S. W., Choi, M. H., Ogunniyi, A. D., Paton, J. C., Park, S. H., et aluminum. ( 2003 ). impression of heat shock and mutations in ClpL and ClpP on virulence gene construction in Streptococcus pneumoniae. Infect. Immun. 71, 3757–3765. department of the interior : 10.1128/IAI.71.7.3757-3765.2003
PubMed Abstract | CrossRef Full Text | Google Scholar Laouami, S., Clair, G., Armengaud, J., and Duport, C. ( 2014 ). Proteomic evidences for king regulation of metamorphosis in toxin-producing Bacillus cereus ATCC 14579. PLoS ONE 9 : e107354. department of the interior : 10.1371/journal.pone.0107354
PubMed Abstract | CrossRef Full Text | Google Scholar Larsson, J. T., Rogstam, A., and Von Wachenfeldt, C. ( 2005 ). Coordinated patterns of cytochrome bachelor of divinity and breastfeed dehydrogenase expression in Bacillus subtilis. Microbiology 151, 3323–3335. department of the interior : 10.1099/mic.0.28124-0
PubMed Abstract | CrossRef Full Text | Google Scholar Lewis, A. M., Matzdorf, S. S., Endres, J. L., Windham, I. H., Bayles, K. W., and Rice, K. C. ( 2015 ). examen of the Staphylococcus aureus azotic oxide reductase ( saNOR ) reveals its contribution to modulating intracellular NO levels and cellular respiration. Mol. Microbiol. 96, 651–669. department of the interior : 10.1111/mmi.12962
PubMed Abstract | CrossRef Full Text | Google Scholar Li, M., Wang, C., Feng, Y., Pan, X., Cheng, G., Wang, J., et alabama. ( 2008 ). SalK/SalR, a two-component bespeak transduction system, is necessity for full virulence of highly invasive Streptococcus suis serotype 2. PLoS ONE 3 : e2080. department of the interior : 10.1371/journal.pone.0002080
PubMed Abstract | CrossRef Full Text | Google Scholar Li, Y., Zheng, J. X., Zhang, H., Fan, H. J., and Lu, C. P. ( 2014 ). effect of Tran on virulence through regulating metabolism and stress allowance of Streptococcus suis serotype 2. Microbiol. Res. 169, 666–674. department of the interior : 10.1016/j.micres.2014.03.002
PubMed Abstract | CrossRef Full Text | Google Scholar Lin, X., Lin, L., Yao, Z., Li, W., Sun, L., Zhang, D., et alabama. ( 2015 ). An integrated quantitative and target proteomics reveals seaworthiness mechanism of Aeromonas hydrophila under oxytetracycline stress. J. Proteome Res. 14, 1515–1525. department of the interior : 10.1021/pr501188g
PubMed Abstract | CrossRef Full Text | Google Scholar Livak, K. J., and Schmittgen, T. D. ( 2001 ). analysis of relative gene formula data using real-time quantitative PCR and the 2 ( -delta delta C ( T ) ) method. Methods 25, 402–408. department of the interior : 10.1006/meth.2001.1262
PubMed Abstract | CrossRef Full Text | Google Scholar Mcgillivray, A., Golden, N. A., Gautam, U. S., Mehra, S., and Kaushal, D. ( 2014 ). The Mycobacterium tuberculosis Rv2745c plays an important function in responding to redox stress. PLoS ONE 9 : e93604. department of the interior : 10.1371/journal.pone.0093604
PubMed Abstract | CrossRef Full Text | Google Scholar Pagels, M., Fuchs, S., Pane-Farre, J., Kohler, C., Menschner, L., Hecker, M., et alabama. ( 2010 ). Redox detection by a Rex-family repressor is involved in the regulation of anaerobic gene expression in Staphylococcus aureus. Mol. Microbiol. 76, 1142–1161. department of the interior : 10.1111/j.1365-2958.2010.07105.x
PubMed Abstract | CrossRef Full Text | Google Scholar Pei, J. Q., Zhou, Q., Jing, L., Li, C., Dai, H., Li, H., et aluminum. ( 2011 ) .The mechanism for regulating ethyl alcohol zymosis by oxidation-reduction levels in Thermoanaerobacter ethanolicus. Metab. Eng. 13, 186–193. department of the interior : 10.1016/j.ymben.2010.12.006
PubMed Abstract | CrossRef Full Text Redding, A. M., Mukhopadhyay, A., Joyner, D. C., Hazen, T. C., and Keasling, J. D. ( 2006 ). Study of nitrate try in Desulfovibrio vulgaris Hildenborough using iTRAQ proteomics. Brief Funct. Genomic Proteomic 5, 133–143. department of the interior : 10.1093/bfgp/ell025
PubMed Abstract | CrossRef Full Text | Google Scholar Reed Lj, M. H. ( 1938 ). A simple method of estimating fifty percentage endpoints. Am. J. Hyg. 27, 493–497 .
Google Scholar Santiago, B., Macgilvray, M., Faustoferri, R. C., and Quivey, R. G. Jr. ( 2012 ). The branched-chain amino acerb transaminase encoded by ilvE is involved in acid permissiveness in Streptococcus mutans. J. Bacteriol. 194, 2010–2019. department of the interior : 10.1128/JB.06737-11
PubMed Abstract | CrossRef Full Text | Google Scholar Tan, C., Liu, M., Liu, J., Yuan, F., Fu, S., Liu, Y., et alabama. ( 2009 ). vaccination with Streptococcus suis serotype 2 recombinant 6PGD protein provides protective covering against S. suis infection in swine. FEMS Microbiol. Lett. 296, 78–83. department of the interior : 10.1111/j.1574-6968.2009.01617.x
PubMed Abstract | CrossRef Full Text | Google Scholar Tang, Y., Zhang, X., Wu, W., Lu, Z., and Fang, W. ( 2012 ). deactivation of the sodium carbonate gene of Streptococcus suis type 2 encoding superoxide dismutase leads to reduced virulence to mice. Vet. Microbiol. 158, 360–366. department of the interior : 10.1016/j.vetmic.2012.02.028
PubMed Abstract | CrossRef Full Text | Google Scholar Unwin, R. D., Griffiths, J. R., and Whetton, A. D. ( 2010 ). coincident analysis of relative protein expression levels across multiple samples using iTRAQ isobaric tags with 2D nano LC-MS/MS. Nat. Protoc. 5, 1574–1582. department of the interior : 10.1038/nprot.2010.123
PubMed Abstract | CrossRef Full Text | Google Scholar Wang, E., Ikonen, T. P., Knaapila, M., Svergun, D., Logan, D. T., and Von Wachenfeldt, C. ( 2011 ). Small-angle roentgenogram scattering cogitation of a Rex syndicate repressor : conformational response to NADH and NAD+ constipate in solution. J. Mol. Biol. 408, 670–683. department of the interior : 10.1016/j.jmb.2011.02.050
PubMed Abstract | CrossRef Full Text | Google Scholar Willenborg, J., De Greeff, A., Jarek, M., Valentin-Weigand, P., and Goethe, R. ( 2014 ). The CcpA regulon of Streptococcus suis reveals novel insights into the regulation of the streptococcal central carbon metamorphosis by binding of CcpA to two discrete binding motif. Mol. Microbiol. 92, 61–83. department of the interior : 10.1111/mmi.12537
PubMed Abstract | CrossRef Full Text | Google Scholar Willenborg, J., Fulde, M., De Greeff, A., Rohde, M., Smith, H. E., Valentin-Weigand, P. et aluminum. ( 2011 ). Role of glucose and CcpA in capsule formulation and virulence of Streptococcus suis. Microbiology 157, 1823–1833. department of the interior : 10.1099/mic.0.046417-0
PubMed Abstract | CrossRef Full Text | Google Scholar Xu, B., Zhang, P., Li, W., Liu, R., Tang, J., and Fan, H. ( 2017 ). hsdS, Belonging to the type I restriction-modification system, contributes to the Streptococcus suis serotype 2 survival ability in phagocytes. Front. Microbiol. 8:1524. department of the interior : 10.3389/fmicb.2017.01524
PubMed Abstract | CrossRef Full Text | Google Scholar Yu, Y., Qian, Y., Du, D., Li, Q., Xu, C., Liu, H., et alabama. ( 2018 ). infection and adaption-based proteomic changes of Streptococcus suis serotype 2 in a hog model. J. Proteomics 180, 41–52. department of the interior : 10.1016/j.jprot.2017.12.001
PubMed Abstract | CrossRef Full Text | Google Scholar Yu, Y., Qian, Y., Du, D., Xu, C., Dai, C., Li, Q., et aluminum. ( 2016 ). SBP2 plays an important function in the virulence changes of different artificial mutants of Streptococcus suis. Mol. Biosyst. 12, 1948–1962. department of the interior : 10.1039/C6MB00059B
PubMed Abstract | CrossRef Full Text | Google Scholar Zhang, C., Sun, W., Tan, M., Dong, M., Liu, W., Gao, T., et aluminum. ( 2017 ). The eukaryote-like serine/threonine kinase STK regulates the growth and metamorphosis of zoonotic Streptococcus suis. Front. Cell Infect. Microbiol. 7:66. department of the interior : 10.3389/fcimb.2017.00066
PubMed Abstract | CrossRef Full Text | Google Scholar Zhang, T., Ding, Y., Li, T., Wan, Y., Li, W., Chen, H., et alabama. ( 2012 ). A Fur-like protein PerR regulates two oxidative stress reaction related operons dpr and metQIN in Streptococcus suis. BMC Microbiol. 12:85. department of the interior : 10.1186/1471-2180-12-85
PubMed Abstract | CrossRef Full Text | Google Scholar Zheng, C., Xu, J., Li, J., Hu, L., Xia, J., Fan, J., et aluminum. ( 2014 ). Two Spx regulators modulate try tolerance and virulence in Streptococcus suis serotype 2. PLoS ONE 9 : e108197. department of the interior : 10.1371/journal.pone.0108197
PubMed Abstract | CrossRef Full Text | Google Scholar Zheng, F., Ji, H., Cao, M., Wang, C., Feng, Y., Li, M., et aluminum. ( 2011 ). contribution of the Rgg transcription regulator to metamorphosis and virulence of Streptococcus suis serotype 2. Infect. Immun. 79, 1319–1328. department of the interior : 10.1128/IAI.00193-10
PubMed Abstract | CrossRef Full Text | Google Scholar Zhu, H., Huang, D., Zhang, W., Wu, Z., Lu, Y., Jia, H., et aluminum. ( 2011 ). The novel virulence-related gene stp of Streptococcus suis serotype 9 stress contributes to a significant reduction in mouse mortality. Microb. Pathog. 51, 442–453. department of the interior : 10.1016/j.micpath.2011.08.002

PubMed Abstract | CrossRef Full Text | Google Scholar Zhu, H., Zhou, J., Ni, Y., Yu, Z., Mao, A., Hu, Y., et aluminum. ( 2014 ). contribution of eukaryotic-type serine/threonine kinase to stress response and virulence of Streptococcus suis. PLoS ONE 9 : e91971. department of the interior : 10.1371/journal.pone.0091971
PubMed Abstract | CrossRef Full Text | Google Scholar

Leave a Reply

Your email address will not be published.